Орындаған: Бекет Арайлым Есекей нұршат Маматкаримова муслима Қабылдаған: Шадманова Л. Ш

Loading...


бет5/6
Дата01.03.2021
өлшемі1.02 Mb.
1   2   3   4   5   6
Сэнгер әдісі

Сэнгер әдісінің схематикалық көрсетілуі

1

4



3

2

Gel electrophoresis



5

Шотган әдісі



Strand

Sequence

Бірінші шотган секвенсі

AGCATGCTGCAGTCATGCT------- -------------------TAGGCTA

Екінші шотган секвенсі

AGCATG-------------------- ------CTGCAGTCATGCTTAGGCTA

Біріңғай ұзын тізбек

AGCATGCTGCAGTCATGCTTAGGCTA

Толық геномды секвенирлеуге арналған

2 - ұрпақты секвенирлеу әдісі: Пиросиквенирлеу әдісі
  • Синтездік секвенирлеу
  • Артықшылығы:


Достарыңызбен бөлісу:
1   2   3   4   5   6
Loading...




©melimde.com 2020
әкімшілігінің қараңыз

    Басты бет
Сабақтың тақырыбы
Сабақтың мақсаты
Сабақ тақырыбы
рсетілетін қызмет
Жалпы ережелер
бойынша жиынтық
ғылым министрлігі
қызмет стандарты
жиынтық бағалау
бекіту туралы
Әдістемелік кешені
туралы хабарландыру
Сабақ жоспары
тоқсан бойынша
бағалауға арналған
Қазақстан республикасы
жиынтық бағалаудың
тоқсанға арналған
Жұмыс бағдарламасы
республикасы білім
Қазақстан республикасының
білім беретін
біліктілік талаптары
арналған жиынтық
әкімінің аппараты
жиынтық бағалауға
туралы анықтама
мамандығына арналған
бағалау тапсырмалары
қойылатын жалпы
Конкурс туралы
жалпы біліктілік
мемлекеттік әкімшілік
арналған әдістемелік
Қазақстан тарихы
арналған тапсырмалар
мерзімді жоспар
жалпы конкурс
бағалаудың тапсырмалары
Мектепке дейінгі
қатысушыларға қойылатын
Қазақ әдебиеті
пәнінен тоқсанға
әдістемелік кешені
Қазақстан облысы
ортақ біліктілік
қызмет регламенті
ткізу туралы
оқыту әдістемесі
мамандығы бойынша
конкурс қатысушыларына

Loading...