Орындаған: Бекет Арайлым Есекей нұршат Маматкаримова муслима Қабылдаған: Шадманова Л. Ш

Loading...


бет5/6
Дата01.03.2021
өлшемі1.02 Mb.
1   2   3   4   5   6
Сэнгер әдісі

Сэнгер әдісінің схематикалық көрсетілуі

1

4



3

2

Gel electrophoresis



5

Шотган әдісі



Strand

Sequence

Бірінші шотган секвенсі

AGCATGCTGCAGTCATGCT------- -------------------TAGGCTA

Екінші шотган секвенсі

AGCATG-------------------- ------CTGCAGTCATGCTTAGGCTA

Біріңғай ұзын тізбек

AGCATGCTGCAGTCATGCTTAGGCTA

Толық геномды секвенирлеуге арналған

2 - ұрпақты секвенирлеу әдісі: Пиросиквенирлеу әдісі
  • Синтездік секвенирлеу
  • Артықшылығы:


Достарыңызбен бөлісу:
1   2   3   4   5   6
Loading...




©melimde.com 2020
әкімшілігінің қараңыз

    Басты бет
Сабақтың тақырыбы
Сабақтың мақсаты
рсетілетін қызмет
Сабақ тақырыбы
Жалпы ережелер
қызмет стандарты
бойынша жиынтық
жиынтық бағалау
ғылым министрлігі
бекіту туралы
Әдістемелік кешені
туралы хабарландыру
тоқсан бойынша
Сабақ жоспары
бағалауға арналған
Қазақстан республикасы
жиынтық бағалаудың
тоқсанға арналған
Жұмыс бағдарламасы
біліктілік талаптары
әкімінің аппараты
арналған жиынтық
туралы анықтама
Қазақстан республикасының
білім беретін
республикасы білім
мамандығына арналған
қойылатын жалпы
Конкурс туралы
жалпы біліктілік
мемлекеттік әкімшілік
жиынтық бағалауға
бағалау тапсырмалары
арналған әдістемелік
Қазақстан тарихы
жалпы конкурс
қатысушыларға қойылатын
арналған тапсырмалар
бағалаудың тапсырмалары
мерзімді жоспар
Қазақ әдебиеті
пәнінен тоқсанға
әдістемелік кешені
Мектепке дейінгі
ортақ біліктілік
Қазақстан облысы
қызмет регламенті
ткізу туралы
конкурс қатысушыларына
біліктілік талаптар
мамандығы бойынша

Loading...