Абиев С. А. 2, Сарсекова Д. Н

Loading...


жүктеу 140.89 Kb.
Дата18.02.2017
өлшемі140.89 Kb.
ӘОЖ: 582.287.238

Морфологиялық белгілері негізінде идентификацияланған Pleurotus pulmonarius (Fr.) Quel. саңырауқұлағының молекулалық верификациясы
Асилханова Р.З.1, Абиев С.А.2, Сарсекова Д.Н.1, Куанышбаев Н.1
1. С.Сейфуллин атын. Қазақ Агротехникалық университеті

2. Л.Н. Гумилев атын. Еуразия Ұлттық университеті
Аннотация
Морфологиялық белгілері негізінде Pleurotus pulmonarius (Fr.) Quel. деп анықталған, агарика саңырауқұлағының түрлік идентификациялық дәлдігін анықтау мақсатында одан бөлініп алынған 4 штаммға: Pp 4, Pp 6, Pp 8, Pp 12 секвендеу әдісін (ITS тізбегінің ретін талдау) қолдану арқылы олардың нуклеотидтік тізбегінің реттік тәртібі анықталды. Алынған мәліметтерді халықаралық Gene Bank базасындағы депонирленген сәйкес штамдардың нуклеотидттік тізбектерінің реттерімін салыстыру арқылы түрлердің арасындағы туыстық филогенетикалық шежіресі құрылды. Дендрограммада біздің штаммдар ГенБанк базасында сақтаулы Pleurotus pulmonarius штаммдарымен бір кладқа сәйкес келді (. Бұл біздің макроморфологиялық ерекшеліктеріне негіздеп анықтаған түріміз толықтай сол түр екенін дәлелдейді.

Түйінді сөздер: идентификация, верификация, штаммдар, нуклеотидтік тізбек, филогенетикалық шежіре.
Саңырауқұлақтарды жүйелеуге арналған Эйнсуорт және Бисби сөздігі («Ainsworth & Bisby's Dictionary of the Fungi») халықаралық ғылыми мекеме  CABI ұйымдастыруымен жарияланып отырады. Бұл басылым 1943 жылдан бастап шығып келе жатыр. Онда саңырауқұлақтың, қыналардың, миксомицеттердің, ашытқы саңырауқұлақтарының таксондарына қатысты мақалалар, микологиялық терминдер, микотоксиндер, штаммдар және тағы басқа саңырауқұлақ метаболиттері жайында мәліметтер, биогеографиялық мәліметтер, микологияның теориялық және қолданбалы аспектілері жарияланады. Бұл Сөздік ғылымның әдістемелік ілгерілеуіне байланысты, саңырауқұлақ таксондарын жүйелеуде жаңа мәліметтердің, жаңалықтардың пайда болуы себебінен толықтырылып бірнеше рет (10 рет) қайта басылып шықты.

Эйнсуорт және Бисбидің 1995 жылы жарық көрген 8-ші басылымында саңырауқұлақ түрлерінің 70%-ы олардың морфологиялық концепциясына негізделіп жүйеленсе, 9-шы басылымында (2001) молекулалық таксономияның 18S рРНҚ гені арқылы жасалған зерттеулер нәтижесінде аскомицеттер мен базидиомицеттер жүйесіне толықтырулар мен өзгертулер енгізілді. Осы Сөздіктің 10-шы басылымында (2008-ші ж.) 5,8S, ITS1/2 және 28S рРНҚ аймақтарының мультигендерін зерттеу нәтижесінде базидиомицеттер мен аскомицеттер кластары қайта жаңадан жүйеленді [1, 2, 3].

Филогеография түрлердің комплекстік және жақын туыстық түрлер арасындағы қатынастарын қарастырады, ол генетиканың бір популяциялық тармағы десек те болады. Сонымен қатар ол филогенетиканың бір бөлімі, себебі микроэволюциялық процесстерді (микрофилогениямен) және генеологиялық линиялардың кеңістік пен уақыттa таралу мәліметтерін талдау арқасында биогеография және экогеография зерттеуімен тығыз байланыста болады [4,5,6]. Филогеографияның экогеографиядан ерекшелігі, экологиялық факторлар мен процесстерді зерттеумен қатар, олардың генетикалық алуантүрлілікке әсерін, алдымен аллелдер мен таксондардың дивергенциясының тарихи себептерін анықтауға бағытталған [7, 8]. Осыған байланысты, филогеография комплекстік бағыт болып саналады.

Филогеографияның дамуына тікелей себеп болған митохондриялық ДНҚ-ын зерттеу (мтДНҚ) генеологияны және олардың кеңістікте таралу моделін құрастыру, молекулалық маркерлерді пайдалану арқылы жүзеге асты. Ең алғашқы филогеографиялық зерттеулер жануарларға, ең алдымен сүтқоректілерге (мтДНҚ) молекулалық маркерді пайдалану арқылы зерттелді [9]. Олардың географиялық таралуына популяцияның генеологиялық құрылымының анық байланысының бар екендігі айқын болды. Дүниежүзілік зоологиялық әдебиеттерде мтДНҚ-ының нуклеотидттік реттік тізбегінің негізінде қолданған молекулалық маркерлер соңғы 30 жыл көлемінде жануарлар тобына (омыртқасыздардан бастап сүтқоректілерге дейін) арналған филогеографиялық жұмыстарда жыл сайын артып отыр. Соңғы статистикалық мәліметтер бойынша [10], жыл сайын жарияланатын филогеографиялық мақалалардың шамамен 57% зоологиялық объекттерге арналған, жоғарғы сатыдағы өсімдіктерге арналғаны 15%, ал саңырауқұлақтардың филогеографиясына қатысты еңбектер 1,8% шамасында.

Саңырауқұлақтардың филогеографиясын зерттеу негізінен биологиялық бақылау бағдарламасы бойынша ауруға шалдыққан, саңырауқұлақтар туғызатын аурулар, немесе ормандағы ағашта патоген тудырушы түрлерден қорғау проблемаларына байланысты, алынған мәліметтер практикалық мақсаттарда ғана қолданылады [11, 12]. Бірақ, популяциялық генетика және патоген емес саңырауқұлақтар мен қыналар жайында бірлі-жарым теориялық проблемалар қарастырылған жұмыстар бар [13,14,15]. Айта кететін болсақ осыған ұқсас мәселелерді негізінен американдық және еуропалық ғалымдар ғана зерттеуде [16,17,18].

Кез келген түрдің таксономиялық зерттеулері, түрдің бір ғана концепциясына негізделеді. Түрлердің бірден бір маңызды теориялық жағы, түрлердің пайда болу филогенезімен - түр ішілік өзгерістерімен (микроэволюция) тікелей байланысты. Осыған орай, түрді статикалық емес динамикалық деп қарастыру маңызды [19, 20].

Қазіргі уақытта түрдің үш негізгі концепциясы қолданыста – морфологиялық, биологиялық және филогенетикалық. Мағынасы жағынан зерттеушілер «эволюциялық түрдің» жіктелу критерияларын қолдануға тырысатын болса, онда ол эволюциялық концепцияның (Evolutionary Species Concept, немесе ESC) туындысы деуге болады [21, 22]. Саңырауқұлақтарды зерттеу тәжірибесіне қарай түрдің филогенетикалық концепциясы (нуклеин қышқылдарының жеке бөліктерінің өзгерісін филогенетикалық талдау) ESC-ге біршама жақын [23]. Десек те саңырауқұлақтар жүйелеуде басым концепцияны морфологиялық концепция алып тұр. Оған дәлел саңырауқұлақтардың 70 мың түрінің сипаттамалары морфологиялық белгілеріне және басқа да фенотиптік ерекшеліктеріне қарай (өсу көрсеткіші, екінші метаболиттік өнімі, пигменттерінің болу-болмауы т.б.) жасалған [1, 24]. Осы концепцияның оңтайлы жағы, осы уақытқа дейінгі бар және жаңадан кірген таксондарды салыстыруға мүмкіндік береді және оны практикада кең қолдануға болады.

Аталған концепцияның кемшілігіне көп жағдайда морфологиялық тұрғыда жақсы шектелген (айқындалған) кейбір түрлердің ішінде бірнеше биологиялық, немесе филогенетикалық түрлердің болуы. Бұған классикалық мысал ретінде Armillaria mellea s. 1. морфологиялық түрін алуға болады. Бұл түрдің моноспоралық изоляттарын шағылыстыру арқасында оның бірнеше жақын туыстық топтарға (биологиялық) бөлінетінін көруге болады [25]. Осындай нәтижелер саңырауқұлақ түрлерінің критериясы мен оларды жүйелеудің перспективасын қайта қарастырудың қажеттігін көрсетеді [26].

Майрдың (1968) анықтамасы бойынша түрдің биологиялық концепциясы деп бір-бірімен шағылыспайтын және жақсы оқшауланған популяциялар тобын айтады [27]. Бұл концепция әртүрлі морфологиялық зерттеулерде, сондайақ саңырауқұлақтарды заманауи жүйелеуде де маңызды орынға ие. Айталық, моноспоралық изоляттарды шағылыстыру тәсілінің көмегімен («mating test») базидиомицеттердің көптеген түрлерінің (Armillaria, Pleurotus, Xeromphalina, Omphalotus т.б.) таксондық жағдайлары анықталды [28]. Дей тұрғанмен, аталмыш концепцияны саңырауқұлақтың әртүрлі таксондық топтарына қолдану кездері бірқатар проблемалар кездесетіні белгілі.

Түрдің филогенетикалық концепциясының негізгі артықшылығы оны кез келген таксондарға, тіпті таза культура бөлуге келмейтін, сәйкесінше оларға «mating test»-ті қолдануға болмайтын таксондарға да қолдануға болады.

Филогенетикалық зерттеулердің негізіне молекулалық маркерлерді пайдалану жатады. Соңғы уақыттары, таксондық зерттеулерде филогенетикалық критериелерді қолданудың дұрыстылығын анықтау үшін консенсустық шежірені («concordance of more than one gene geneology») құруға маңызды бірнеше маркерлерді бір уақытта қолданады [29].

Саңырауқұлақтарды жүйелеуге арналған молекулалық зерттеулердің басталғанынан (ХХ ғысырдың 80-ші жылдарынан) бастап осы уақытқа дейін өте көп мәліметтер жинақталды. Дүниежүзілік электрондық мәліметтер GenBank базасында http://www.ncbi.nlm.nih.gov/Genbank/) қазіргі күнде тек гомобазидиомицеттердің шамамен 14 мың таксонға жататын 180 мың нуклеотидттік тізбектен асатын мәліметтері жинақталған.

Бірақ таксондардың туыстық қарым-қатынасын анықтауға арналған филогенетикалық концепцияны бір жақты қолдану және жүйені тек осыған негіздеп құру, эволюциялық процессті дұрыс түсінбеуге алып келуі мүмкін. Өте қарапайым құрылған организмдердің өзінде де гендерінің санының өте көп екені белгілі. Тек қана бір, немесе бірнеше гендердің эволюциялық заңдылықтарына сүйеніп таксонның эволюциялық үдерісін жасау дұрыс нәтиже бермеуі мүмкін. Сондықтан тек қана кешенді зерттеу, яғни молекулалық және басқа да белгілерді қоса талдау табиғи жүйені дұрыс құруға мүмкіндік беретін жалғыз дұрыс бағыт болып табылады [30, 31].

Өсімдіктер мен саңырауқұлақтардың филогениясын зерттеуде көп жағдайда рибосомдық ДНҚ (рДНК) гендерін, микросателлиттерді, тубулиндік және басқа да құрылымдық гендерді, сонымен қатар ішкі тасымалданатын (ITS1 және ITS2), сыртқы тасымалданатын (ETS) және гендераралық (IGS), және тасымалданбайтын (NTS) спейсерлер деп аталатын рДНҚ-ның индивидуальдық гендерін бөліп тұратын өзгергіш тізбектерін пайдаланады.

Молекулалық-генетикалық зерттеулердің санының өсуі, тек жануарлардың және жоғары сатыдағы өсімдіктердің ғана емес, сонымен қатар саңырауқұлақтардың, қарапайымдылардың, бактериялардың континент аралық және бір континенттің ішіндегі түрлердің филогеографиялық құрылымын көрсетуге мүмкіндік береді.

Қазіргі таңдағы саңырауқұлақтарды жүйелеуде түрлер аралық, туыс ішілік және туыс аралық филогенетикалық байланыстарды анықтауға арналған бірнеше генетикалық маркерлер қолданылады. Осыған ұқсас зерттеулерді аско- және базидиомицеттерде жүргізу үшін жиі пайдаланатын «стандартты жинақ» маркерлерге ITS, EF 1-α, nLSU гендері және көп жағдайда mtSSU (митохондриальды ДНҚ рибосомасының кішісуббірлік гендері) жатады [32,33,34,35]. Солтүстік Америкадан алынған Sphaerobolus-тың 27 изолятына жүргізілген мультигенді филогенетикалық талдау туыстың үш дивергентті линиядан тұратынын айқындады (бұрын екі түр делінетін) [36,37]. Agrocybe aegerita комплексін зерттеуге арналған жұмыста [38,39] түрдің географиялық (Еуропа, Оңтүстік Америка, Азия және Солтүстік Америка) таралуына сәйкес, бір-бірінен дербес үш түрге жататын кладтардан тұратыны анықталды.



Зерттеу материалдары мен әдістері

Саңырауқұлақ ДНҚ-сын бөліп алу. Саңырауқұлақ ДНҚ-сын бөліп алу үшін келесі құрамдағы буферлі ерітінділер қолданылды: 100 mM Tris-HCl, pH 8,0, 1,4 M NaCl, 20 mM EDTA, 2% CTAB, К протеиназасы 100 g/ml [40]. 10-12 тәуліктік мицелийлік культураны стерильді ступкаға салып, оған сұйық азот қосып гомогенді күйге дейін ездік. Осылай алынған суспензияның 100 мкл-ін стерильді 1,5 мл пробиркаға құйып оған 500 мкл жоғарыдағы құрамдағы буферлі ерітіндіні қостық. Дайын болған пробиркадағы сұйықтықты вортекспен гомогенді күйге дейін араластырып 18 сағатқа инкубацияладық. Содан соң бөлініп алынған ДНҚ фенол/хлороформ әдісімен тазаланды. Ол үшін алынған суспензияға 750 мкл хлороформ/изоамил спиртін (24:1) қосып, центрифугаға 10 минутқа 12000 мин./айналымға қойдық. Бөлінген су бөлігін 1,5 мл пробиркаға құйып алып, тағы да (1:1) фенол/хлороформ қоспасын қосып культураның бізге қажет емес басқа белок және клетка мембранасының қалдықтарынан тазаладық. Центрифугадан соң тағы да жоғарғы сұйықтық бөлігін жаңа 1,5 мл пробиркаға 600 мкл изопропил спиртімен ДНҚ-ны тұндырып алып, 10 минут 12000 минутына/айналыммен центрифугирледік. Пробирканың түбінде тұнған ДНҚ ны 70%-ті этил спиртімен шайып алып, кезекті рет центрифугирлеп, пробиркадағы сұйық фазасын төгіп тастадық. Түбінде қалған тұнбаны 15 мин. бойы ауада кептірдік. Пробиркадағы ДНҚ үлгілеріне бір рет 100 мкл ТЕ буферін араластырып, минус 20°С-та мұздатқышқа сақтауға қойдық. Бөлініп алынған ДНҚ үлгілерінің концентрациясын 260 нм толқын ұзындығында NanoDrop спектрометрдің көмегімен анықтадық. Амплификацияланатын ДНҚ үлгілерінің концентрациясы 3-5 пмоль-ден аспау тиіс. Сондықтан амплификацияланатын ДНҚ үлгілеріне, ПТР реакциясы нәтижелі жүру үшін, концентрациясы 3-5 пмоль дан аспайтындай етіп дистилденген су қосылды.

ITS1-5,8S-ITS2 тізбегінің амплификациясы. ПТР-ді келесідей праймерлермен жүргіздік ITS 5 5’ – ggaagtaaaagtcgtaacaagg-3’ және ITS 4 5’– tcctccgcttattgatatgc -3’, жалпы көлемі 30 мкл реакциялық қоспа болады. ПТР қоспа 40 нг ДНҚ, 1 бірлік Taq DNA Polymerase (Fermentas), әрқайсысына 0,2 mM дНҮФ (дезоксинуклеозодүшфосфат), бір реттік ПТР буфер (Fermentas), 2,5 mM MgCl2, әрқайсысына 10 пмоль праймер. ПТР амплификациясының бағдарламасы бірінші 95°С 4 минут аралығында денатурация, 30 циклмен кезектесетін: 95°С – 25 секунд, 52°С- 30 секунд, 72°С – 40 секунд; 7 минут 72°С температурамен соңғы элонгациямен аяқталады. ПТР-ді DNA Engine Tetrad 2 Cycler PTC-0240 (Bio-Rad) амплификаторында жүзеге асырылды.

Электрофорез процесі 1% агарозды гель арқылы жүзеге асырылды. Электрофорез жүргізу үшін 1хТАЕ буфері дайындалып келесідей құрамдағы: 50хТАЕ-20 мл, H2O-980 мл, 1% агарозды гель даярлау үшін 1хТАЕ нің 70 мл-не 0,7 гр агароза алынды. Дайындалатын 1% агарозды гельге 5 мкл этидиум бромид ерітіндісін қосып, плашкаға құйып, екі жақ шетіне тарақшаны орналастырып гель қатқанша күтеміз, дайын болған 1% агарозды гельдің бірінші ұяшығына DNA Ludder Mix, одан кейінгі әрбір лункасына 8 мкл қанықкөк бояуымен амплификацияланған ДНҚ үлгілерінің әрқайсысынан 5 мкл алып, қанықкөк бояуымен араластырып, әрбір лункаға құямыз. Электрофорез жүру үшін 15 минутке 150V-ке қойылды. ДНҚ фрагментінің бары-жоғын және санын анықтауды трансэлюминатордың құжаттама бағдарламасында жүргіздік.



Нуклеотидттік тізбекті анықтау әдістері

ПТР өнімді байланыспаған праймерлерден тазалауды келесі әдіспен жүргіздік: 5М ацетатты амоний мен этанол арқылы. Келесідей құрамдас қоспалармен ДНҚ үлгілері тазаланды: барлығы бір пробаға 50 ul қоспа, dd H2O – 4,7 ul, NH4Ac 5M – 1,5 ul, ETOH 43,8 ul.

100 мкл аммоний ацетатының этанолмен қоспасын 20 мкл ПТР қоспасымен вортексте, немесе қолмен аударыптөңкеру арқылы араластырып, сонан соң бөлме температурасында 20 минут бойы тұндырып, 20 минут бойы 14000 мин/айналымда центрифугалап, үстіне шыққан сұйықтықты, немесе супернатантты бөлініп алып тастап, қалған тұнбаны 70%-дық, минус 20ºСтағы 1000 мкл этанолмен шайып, термостатта 50ºС-та кептірдік.

Секвендеу реакциясы BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) өндірушінің қолдану ережесіне сәйкес, 3730xl DNA Analyzer (Applied Biosystems) автоматты генетикалық анализаторде, фрагменттерге кезекпен бөлетін секвенаторды пайдалану арқылы жүзеге асырылды.

Саңырауқұлақ штаммдарының молекулалық идентификациясын жасауда ITS аймағының нуклеотидттік тізбегін анықтай келе және оның депонирленген культуралардың нуклеотидттік тізбегінің GenBank (www.ncbi.nlm.nih.gov) мәліметтер базасындағы BLAST бағдарламасын пайдаланып нуклеотидттік тізбектің біздің алынған нуклеотидттік тізбекпен ұқсастығын анықтадық.

Біздер анықтаған саңырауқұлақ түрлерінің идентификациялық дәлдігін верификациялау олардан бөлініп алынған штамдардың ITS аймағының нуклеотидттік тізбегінің сипаттамаларын, BLAST бағдарламасын пайдалану арқылы, GenBank (www.ncbi.nlm.nih.gov) мәліметтер базасындағы сәйкес түрлердің нуклеотидттік тізбектерімен салыстыру (ұқсастық деңгейі) арқылы жүзеге асырылды.



Зерттеу нәтижелері және талдау

Агарика саңырауқұлақтарын гендік типтеу

Нуклеотид тізбектерінің реттігін талдау

Гендік типтеу мақсатында алынған, морфологиялық белгілері негізінде Pleurotus pulmonarius (Fr.) Quel. деп анықталған, агарика саңырауқұлағының түрлік идентификациялық дәлдігін анықтау үшін одан бөлініп алынған 4 штаммға: Pp 4, Pp 6, Pp 8, Pp 12 секвендеу әдісін (ITS тізбегінің ретін талдау) қолдандық. Аталған штаммдарды секвендеу негізінде олардың ITS нуклеотидттік тізбегінің реттіктері анықталды. Сонан соң нуклеотид тізбегінің реттері талданып, алынған тізбек SeqMan (DNAStar) бағдарламасына енгізілді. Кейіннен олардың ұштық фрагменттері (сапасы төмен праймерлері мен фрагменттердің нуклеотидті көрсететін реттері) алып тасталды. Алынған тізбек Gene Bank мәліметтер базасындағы BLAST алгоритмін пайдалана отырып идентификацияланды. Алынған нәтижелерді есептеу секвенделген ITS тізбегінің 705 сайттары бойынша жүргізілді.

Осы алынған мәліметтерді халықаралық Gene Bank базасындағы депонирленген штамдардың нуклеотидттік тізбектерінің реттерімін салыстыру арқылы түрлердің арасындағы туыстық қарым-қатынастарын көрсететін олардың филогенетикалық шежіресі құрылды. Филогенетикалық шежірені құру Mega 6 компьютерлік бағдарламасы (ML) пакетіндегі ақиқатқа барынша жақындату әдісі [41] арқылы жүзеге асырылды.

Нәтижесінде біз зерттеген агарикалар қатарына жататын саңырауқұлақ Pleurotus pulmonarius-тың 4 штаммының да (Pp 4, Pp 6, Pp 8, Pp 12) нуклеотидтік тізбегінің реттік тәртібі осы саңырауқұлақтардың GenBank-тегі ITS нуклеотидттік тізбектерінің реттерімен JX535494.1 99% ұқсастығын (гомологтылығын) көрсетті. Аталған штамдардың нуклеотидттік тізбектерінің реттері негізінде осы түрлерінің арасындағы филогенетикалық туыстық қарым-қатынастары анықталды (1-ші суретте).

Дендрограммада Pp 4, Pp 6, Pp 8, Pp 12 штаммдары ГенБанк базасында сақтаулы Pleurotus pulmonarius штаммдарымен бір кладқа сәйкес келді (1-ші суретте). Сондықтан біздің макроморфологиялық ерекшеліктеріне негіздеп анықтаған түріміз толықтай сол түр екенін дәлелдеді.

1-сурет. Pleurotus pulmonarius (Pp 4, Pp 6, Pp 8, Pp 12) штаммдарының дендрограммасы


Пайдаланылған әдебиеттер тізімі:

1.Hawksworth D., Kirk P., Sutton B., Pegler D. Ainsworth’s and Bisby’s Dictionary of the fungi. - 8th ed. / CABI. - Wallingford, 1995. - 616 p.



2.Ainsworth G.C., Kirk P.M., Bisby G.R. Ainsworth & Bisby's Dictionary of the Fungi. - 9th ed. / CABI. Wallingford, 2001. 655 p.

3.Kirk P.M., Cannon P.F., Minter D.W. et al. Ainsworth & Bisby's Dictionary of the Fungi / CABI. – Wallingford, 2008. – 771 p.

4.Honig K., Riefler M., Kottke I. Survey of Paxillus involutus (Batsch) Fr. Inoculum and fruitbodies in a nursery by IGS-RFLPs and IGS sequences // Mycorrhiza. - 2000. - Vol. 9. - P. 315-322.

5.Imamjomen A., Soluki M., Taheri F., Nikfetrat A. Comparison of DNA extraction methods in Agaricus bisporus by Random and Semi Random PCR (RAPD and ISJ markers) // Procceedings of the 2006 WSEAS Int. Conf. on Cellular and Molecular Biology, Biophysics and Bioengineering. – Athens, 2006. – P. 63-68.

6.Faal Ch. et. al. Preparation of AFLP mediated–molecular certificate for 12 bred strains of the button mushroom, Agaricus bisporus // J. Plant Protec. – 2009. – Vol. 23(1). – P. 58-67.

7.Morgenstern I., Klopman S., Hibbett D.S. Molecular evolution and diversity of lignin degrading heme peroxidases in the Agaricomycetes // J. Mol. Evol. – 2008. – Vol. 66. – P. 243-257.

8.Manjunathan J., Kumar M., Kaviyarasan V. Taxonomic studies, rapid and efficient protocol for DNA extraction, purification, molecular characteristics of the Basidiomycete Lentinus tubberregium (FR) GQ292711 // Asian J Pharm Clin Res. – 2011. – Vol. 4(2). – P. 54-58.

9.Gaston K.J., Chown S.L., Evans K.L. Ecogeographical rules: elements of a synthesis // J. Biogeogr. - 2008. - Vol. 35. - P. 483-500.

10.Beheregaray L.B. Twenty years of phylogeography: the state of the field and the challenges for the Southern Hemisphere // Mol. Ecol. - 2008. - Vol. 17. - P. 3754-3774.

11.Kohn L.M. Mechanisms of fungal speciation // Annu. Rev. Phytopathol. - 2005. - Vol. 43. - P. 279-308.

12.Reddy M.P. et al. Inter simple sequence repeat (ISSR) polymorphism and its application in plant breeding // Eyphytica. – 2002. – Vol. 128. – P. 9-17.

13.Hughes K.W., McGhee L.L., Methven A.S. et al. Patterns of geographic speciation in the genus Flammulina based on sequences of the ribosomal ITS1-5,8S-ITS2 area // Mycologia. - 1999. - Vol. 91, №6. - P. 978-986.

14.Isikhuemhen O.S., Moncalvo J.M., Nerud F., Vilgalys R. Mating compatibility and phylogeography in Pleurotus tuberregium // Mycol. Res. - 2000. - Vol. 104, №6. - P. 732-737.

15.Petersen R.H., Hughes K.W. Phylogeographic examples of Asian biodiversity in mushrooms and their relatives // Fungal Div. - 2003. - Vol. 13. - P. 95-109.

16.Halling R.E., Osmundson T.W., Neves M.A. Pacific boletes: implications for biogeographic relationships // Mycol. Res. - 2008. - Vol. 112. - P. 437-447.

17.Bruns T.D., White T.J., Taylor J.W. Fungal molecular systematic // Annual Review of Ecology and Systematics. – 1991. – Vol. 22. – P. 525-564.

18.Gardes M., White T.J., Fortin J.A. et al. Identification of indigenous and introduced symbiotic fungi in ectomycorrhizae by amplification of nuclear and mitochondrial ribosomal DNA // Can. J. Bot. – 1991. – Vol. 69. – P. 180-190.

19.Коваленко А.Е., Малышева В.Ф., Малышева Е.Ф. Филогеография как новое направление микологических исследований // В кн.: Микология и фитопатология. – СПб., 2011. – Т. 45. – С. 303-311.

20.Henrion B., Chevalier G. and Martin F. Typing truffle species by PCR amplication of the ribosomal DNA spacers // Mycol. Res. – 1994. – Vol. 99. – P. 1321-1324.

21.Майр Э. Принципы зоологической систематики. – М.: Мир, 1971. - 454 с.

22.Bruns T.D., Fogel R., Taylor J.W. Amplification and sequencing of DNA from fungal herbarium specimens // Mycologia. – 1990. – Vol. 82(2). – P. 175-184.

23.Avise J.C., Wollenberg K. Phylogenetics and the origin of species // Proc. Natl. Acad. Sci. USA. - 1997. - Vol. 94. - P. 7748-7755.

24.Taylor J.W., Jacobson D.J., Kroken S. et al. Phylogenetic species recognition and species concepts in fungi // Fungal Genet. Biol. - 2000. - Vol. 31. - P. 21-32.

25.Besl H., Bresinsky A. Chemosystemstics of Suillaceae and Gomphidiaceae (suborder Suillineae) // Plant Syst. Evol. - 1997. - Vol. 206. - P. 223-242.

26.Kasuga T., Taylor J.W., White T.J. Phylogenetic relationships of varieties and geographical groups of the human pathogenic fungus, Histoplasma capsulatum Darling // J. Clin. Microbiol. - 1999. - Vol. 37. - P. 653-663.

27.Hibbett D.S., Donoghue M.J. Implications of phylogenetic studies for conservation of genetic diversity in shiitake mushrooms // Conserv. Biol. - 1996. - Vol. 10. - P. 1321-1327.

28.Майр Э. Зоологический вид и эволюция. - М.: Мир, 1968. - 597 с.

29.Peterson R.H., Hughes K.W. Species and speciation in mushrooms // Bioscience. - 1999. - Vol. 49. - P. 440-452.

30.Vilgalys R., Sun B.L. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences // Proc. Natl. Acad. Sci. USA. - 1994. - Vol. 91. - P. 4599-4603.

31.А.С. Геномика и геносистематика // Природа. - 1999. - №6. - С. 19-26.

32.Chapela I.H., Garbelotto M. Phylogeography and evolution in matsutake and close allies inferred by analyses of ITS sequences and AFLPs // Mycologia. - 2004. - Vol. 96, №4. - P. 730-741.

33.Moncalvo J.M., Drehmel D., Vilgalys R. Variation in Modes and Rates of Evolution in Nuclear and Mitochondrial Ribosomal DNA in the Mushroom Genus Amanita (Agaricales, Basidiomycota): Phylogenetic Implications // Mol. Phylogenet. Evolut. - 2000. - Vol. 16(1). - P. 48-63.

34Hofstetter V., Clemencon H., Vilgalys R., Moncalvo J.M. Phylogenetic analyses of the Lyophylleae (Agaricales, Basidiomycota) based on nuclear and mitochondrial rDNA sequences // Mycol. Res. - 2002. - Vol. 106(9). - P. 1043-1059.

35Абиев С.А., Шнырева А.В., Нам Г.А., Асилханова Р.З., Абишева Г. Съедобные грибы порядка Аgaricales особо охраняемых природных территорий центрального и северовосточного казахстана: создание коллекции штаммов и их молекулярная идентификация // Известия Национальной академии наук Республики Казахстан. Серия Биологическая и медицинская. - Алматы, 2015. - №3 (309). - C. 154-161.

36Шнырева А.В. Геносистемактика и проблема вида у грибов: подходы и решения // В кн.: Микология и фитопатология. - СПб., 2011. – Т. 45. - С. 209-219.

37.Hibbet D.S., Vilgalys R. Phylogenetic relationships of the Basidiomycete genus Lentinus inferred from molecular and morphological characters // J. Syst. Bot. – 1993. – Vol. 18. – P. 409-433.

38.Geml J., Davis D.D., Geiser D.M. Phylogenetic analyses reveal deeply divergent species lineages in the genus Sphaerobolus (Phallales: Basidiomycota) // Mol. Phylogenet. Evolut. - 2005. - Vol. 35. - P. 313-322.

39.Uhart M., Sirand–Pugnet P., Labarere J. Evolution of mitochondrial SSU-rDNA variable domain sequences and rRNA secondary structures, and phylogeny of the Agrocybe aegerita multispecies complex // Res. Microbiol. - 2007. - Vol. 158. - P. 203-212.

40.Soltis Lab CTAB DNA Extraction Protocol. The Soltis Lab, Florida Museum of Natural History. – 2002 // http://www.flmnh.ufl.edu/soltislab.

41.Tamura K., Peterson D., Peterson N. et al. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods // Molecular Biology and Evolution. – 2011. – Vol. 28. – P. 2731-2739.
Резюме

Асилханова Р.З.1, Абиев С.А.2, Сарсекова Д.Н.1, Куанышбаев Н.1 Молекулярная верификация гриба, идентифицированного на основе морфопризнаков, как Pleurotus pulmonarius (Fr.) Quel.


Проверка точности идентификации Pleurotus pulmonarius осуществлялась путем сравнения характеристики нуклеотидных последовательностей ITS региона у 4 штаммов (Pp 4, Pp 6, Pp 8, Pp 12), выделенных из природных популяции данного гриба (с использованием Программы BLAST) с нуклеотидными последовательностями соответствующего вида (JX535494.1 Pleurotus pulmonarius), депонированных в базе данных GenBank. Результаты показали 99%ное соответствия всех наших 4 штаммов с соответствующими сравниваемыми штаммами GenBank. Создана общее филогенетическое древо (дендрограмма), филогенетические родственные отношения с другими родственными видами. Все эти данные подтверждают правильность идентификации данного вида, проведенного нами ранее на основа макроморфологических признаков.

Ключевые слова: идентификация, верификация, штаммы, нуклеотидная последовательность, филогенетическое древо.
Summary

Asilhanova R.Z.1, Abiyev S.A.2, Sarsekova D.N.1 Kuanishbaev N.1 Molecular verification of the fungus, identified on the basis of morphological characters as Pleurotus pulmonarius (Fr.) Quel.


     Checking the accuracy of the identification of Pleurotus pulmonarius carried out by comparing the characteristics of the nucleotide sequences of ITS region in 4 strains (Pp 4, Pp 6, Pp 8, Pp 12), isolated from natural populations of the fungus (using BLAST programs) with the nucleotide sequences of the respective type (JX535494. 1 Pleurotus pulmonarius), deposited in the GenBank data base. The results showed 99% compliance of all our 4 strains of being compared with the corresponding strains GenBank. Common phylogenetic tree (dendrogram), phylogenetic relationships with other related species are created. All these data confirm the correctness of the identification of the species, which previously were conducted on the basis of macromorphological characters.

Keywords: identification, verification, strains, nucleotide sequence, phylogenetic tree.
: sites -> default -> files -> publications
publications -> Мысыр араб республикасының лаңкестікке қарсы күрес жүргізу тәжірибесі
publications -> Орталық Азиядағы ядролық қарудан азат аймаққа қатысты ядролық державалардың ұстанымы Аңдатпа
publications -> Ғылыми жетекші: Омарова А. К. «Қаржы» кафедрасының оқытушысы
publications -> Қазақстан Республикасының экологиялық жағдайы
publications -> Профессор Қ. Жұбанов және қазақ терминологиясындағы мәселелер
publications -> Интерактивті маркетингтің артықшылықтары мен кемшіліктері
publications -> Экология ғылымы және негізгі бөлімдері. Мақсаты
publications -> Экология ғылымы және негізгі бөлімдері. Аплатин Қарақат Ақпараттық жүйелер-16 тобының студенті
publications -> Білімнің биік ордасы. Высокий центр знании.)
publications -> МӘС бөлімінде куәландыру (қайта куәландыру)тәртібі


Достарыңызбен бөлісу:
Loading...


©melimde.com 2019
әкімшілігінің қараңыз

    Басты бет

Loading...